Synthesized:Article Title: CRISPR.BOT an autonomous platform for streamlined genetic engineering and molecular biology applications.
Article Snippet: .. The previously designed 3 gRNA sequences were synthesized with the pU6 promoter by GenScript and cloned into the lentiviral pHIV-EGFP (Addgene, #21373) plasmid14 For lentivirus production, CRISPR-Prime Editing system encoding lentiviral pLenti-PE2-BSD plasmid DNAs (Addgene, # 161514) encoding CRISPRPE containing the blasticidin resistance gene, control pHIV-EGFP non-coding pegRNA1/2/3, and coding GFP and pHIV EGFP coding pU6-pegRNA1/2/3 and GFP were transfected with pSPAX2 and pVSV-G envelope and packaging plasmid DNAs. ..
Article Title: CRISPR.BOT an autonomous platform for streamlined genetic engineering and molecular biology applications
Article Snippet: .. The previously designed 3 gRNA sequences were synthesized with the pU6 promoter by GenScript and cloned into the lentiviral pHIV-EGFP (Addgene, #21373) plasmid For lentivirus production, CRISPR-Prime Editing system encoding lentiviral pLenti-PE2-BSD plasmid DNAs (Addgene, # 161514) encoding CRISPR-PE containing the blasticidin resistance gene, control pHIV-EGFP non-coding pegRNA1/2/3, and coding GFP and pHIV EGFP coding pU6-pegRNA1/2/3 and GFP were transfected with pSPAX2 and pVSV-G envelope and packaging plasmid DNAs. ..
Clone Assay:Article Title: CRISPR.BOT an autonomous platform for streamlined genetic engineering and molecular biology applications.
Article Snippet: .. The previously designed 3 gRNA sequences were synthesized with the pU6 promoter by GenScript and cloned into the lentiviral pHIV-EGFP (Addgene, #21373) plasmid14 For lentivirus production, CRISPR-Prime Editing system encoding lentiviral pLenti-PE2-BSD plasmid DNAs (Addgene, # 161514) encoding CRISPRPE containing the blasticidin resistance gene, control pHIV-EGFP non-coding pegRNA1/2/3, and coding GFP and pHIV EGFP coding pU6-pegRNA1/2/3 and GFP were transfected with pSPAX2 and pVSV-G envelope and packaging plasmid DNAs. ..
Article Title: An intron-based timer for circadian rhythms
Article Snippet: .. In brief, two gRNAs GTTCACTGGCGTCGAACTTG (gRNA-1) and GAACCTTGAGACCACTCCGC (gRNA-2) where cloned into the gRNA expression plasmid pU6-BbsI-chiRNA (Addgene #45946) using restriction enzyme (BbsI) cloning, which were confirmed by Sanger sequencing with T7 primer and prepared using Midi-prep (QIAGEN). .. Donor plasmid was cloned with the pBlueScriptII SK(-) backbone (GenScript, Inc.) which contains complete flanking exons of intron P with PAM sequences mutated to maintain the coding amino acid sequence (gRNA-1 PAM mutated to AGA and gRNA-2 PAM mutated to AGC). gRNA and donor plasmids were microinjected into germline Cas9 expression embryos (nos-Cas9 attp2, Rainbow Transgenic Flies, Inc.) and crossed individually with chr2 balancer line.
Article Title: CRISPR.BOT an autonomous platform for streamlined genetic engineering and molecular biology applications
Article Snippet: .. The previously designed 3 gRNA sequences were synthesized with the pU6 promoter by GenScript and cloned into the lentiviral pHIV-EGFP (Addgene, #21373) plasmid For lentivirus production, CRISPR-Prime Editing system encoding lentiviral pLenti-PE2-BSD plasmid DNAs (Addgene, # 161514) encoding CRISPR-PE containing the blasticidin resistance gene, control pHIV-EGFP non-coding pegRNA1/2/3, and coding GFP and pHIV EGFP coding pU6-pegRNA1/2/3 and GFP were transfected with pSPAX2 and pVSV-G envelope and packaging plasmid DNAs. ..
CRISPR:Article Title: CRISPR.BOT an autonomous platform for streamlined genetic engineering and molecular biology applications.
Article Snippet: .. The previously designed 3 gRNA sequences were synthesized with the pU6 promoter by GenScript and cloned into the lentiviral pHIV-EGFP (Addgene, #21373) plasmid14 For lentivirus production, CRISPR-Prime Editing system encoding lentiviral pLenti-PE2-BSD plasmid DNAs (Addgene, # 161514) encoding CRISPRPE containing the blasticidin resistance gene, control pHIV-EGFP non-coding pegRNA1/2/3, and coding GFP and pHIV EGFP coding pU6-pegRNA1/2/3 and GFP were transfected with pSPAX2 and pVSV-G envelope and packaging plasmid DNAs. ..
Article Title: Construction and Expression Analysis of the bin 3xOllas Tool Line
Article Snippet: Briefly, a bin.3×Ollas pBluescript II KS (-) (GenScript) donor was constructed containing 782 bp upstream and 776 bp downstream homology arms flanking a sequence encoding three tandem 14 amino acid Ollas tags (SGFANELGPRLMGK–SGFANELGPRLMGK–SGFANELGPRLMGK). .. The pU6-BbsI-chiRNA gRNA expression vector (Addgene) carrying two CRISPR target sites (5′-TAGGCCGGCTTGCGATCAATGGG-3′ and 5′-ATGCACGCCATCCCAAGTTGAGG-3′) was injected together with the bin.3xOllas donor into y 1 M{vas-Cas9}ZH-2A embryos (Bloomington 51323) by BestGene Inc.. .. The bin 3×Ollas allele was confirmed by Sanger sequencing (GATC services, Eurofins).
Article Title: CRISPR.BOT an autonomous platform for streamlined genetic engineering and molecular biology applications
Article Snippet: .. The previously designed 3 gRNA sequences were synthesized with the pU6 promoter by GenScript and cloned into the lentiviral pHIV-EGFP (Addgene, #21373) plasmid For lentivirus production, CRISPR-Prime Editing system encoding lentiviral pLenti-PE2-BSD plasmid DNAs (Addgene, # 161514) encoding CRISPR-PE containing the blasticidin resistance gene, control pHIV-EGFP non-coding pegRNA1/2/3, and coding GFP and pHIV EGFP coding pU6-pegRNA1/2/3 and GFP were transfected with pSPAX2 and pVSV-G envelope and packaging plasmid DNAs. ..
Plasmid Preparation:Article Title: CRISPR.BOT an autonomous platform for streamlined genetic engineering and molecular biology applications.
Article Snippet: .. The previously designed 3 gRNA sequences were synthesized with the pU6 promoter by GenScript and cloned into the lentiviral pHIV-EGFP (Addgene, #21373) plasmid14 For lentivirus production, CRISPR-Prime Editing system encoding lentiviral pLenti-PE2-BSD plasmid DNAs (Addgene, # 161514) encoding CRISPRPE containing the blasticidin resistance gene, control pHIV-EGFP non-coding pegRNA1/2/3, and coding GFP and pHIV EGFP coding pU6-pegRNA1/2/3 and GFP were transfected with pSPAX2 and pVSV-G envelope and packaging plasmid DNAs. ..
Article Title: Construction and Expression Analysis of the bin 3xOllas Tool Line
Article Snippet: Briefly, a bin.3×Ollas pBluescript II KS (-) (GenScript) donor was constructed containing 782 bp upstream and 776 bp downstream homology arms flanking a sequence encoding three tandem 14 amino acid Ollas tags (SGFANELGPRLMGK–SGFANELGPRLMGK–SGFANELGPRLMGK). .. The pU6-BbsI-chiRNA gRNA expression vector (Addgene) carrying two CRISPR target sites (5′-TAGGCCGGCTTGCGATCAATGGG-3′ and 5′-ATGCACGCCATCCCAAGTTGAGG-3′) was injected together with the bin.3xOllas donor into y 1 M{vas-Cas9}ZH-2A embryos (Bloomington 51323) by BestGene Inc.. .. The bin 3×Ollas allele was confirmed by Sanger sequencing (GATC services, Eurofins).
Article Title: An intron-based timer for circadian rhythms
Article Snippet: .. In brief, two gRNAs GTTCACTGGCGTCGAACTTG (gRNA-1) and GAACCTTGAGACCACTCCGC (gRNA-2) where cloned into the gRNA expression plasmid pU6-BbsI-chiRNA (Addgene #45946) using restriction enzyme (BbsI) cloning, which were confirmed by Sanger sequencing with T7 primer and prepared using Midi-prep (QIAGEN). .. Donor plasmid was cloned with the pBlueScriptII SK(-) backbone (GenScript, Inc.) which contains complete flanking exons of intron P with PAM sequences mutated to maintain the coding amino acid sequence (gRNA-1 PAM mutated to AGA and gRNA-2 PAM mutated to AGC). gRNA and donor plasmids were microinjected into germline Cas9 expression embryos (nos-Cas9 attp2, Rainbow Transgenic Flies, Inc.) and crossed individually with chr2 balancer line.
Article Title: CRISPR.BOT an autonomous platform for streamlined genetic engineering and molecular biology applications
Article Snippet: .. The previously designed 3 gRNA sequences were synthesized with the pU6 promoter by GenScript and cloned into the lentiviral pHIV-EGFP (Addgene, #21373) plasmid For lentivirus production, CRISPR-Prime Editing system encoding lentiviral pLenti-PE2-BSD plasmid DNAs (Addgene, # 161514) encoding CRISPR-PE containing the blasticidin resistance gene, control pHIV-EGFP non-coding pegRNA1/2/3, and coding GFP and pHIV EGFP coding pU6-pegRNA1/2/3 and GFP were transfected with pSPAX2 and pVSV-G envelope and packaging plasmid DNAs. ..
Control:Article Title: CRISPR.BOT an autonomous platform for streamlined genetic engineering and molecular biology applications.
Article Snippet: .. The previously designed 3 gRNA sequences were synthesized with the pU6 promoter by GenScript and cloned into the lentiviral pHIV-EGFP (Addgene, #21373) plasmid14 For lentivirus production, CRISPR-Prime Editing system encoding lentiviral pLenti-PE2-BSD plasmid DNAs (Addgene, # 161514) encoding CRISPRPE containing the blasticidin resistance gene, control pHIV-EGFP non-coding pegRNA1/2/3, and coding GFP and pHIV EGFP coding pU6-pegRNA1/2/3 and GFP were transfected with pSPAX2 and pVSV-G envelope and packaging plasmid DNAs. ..
Article Title: CRISPR.BOT an autonomous platform for streamlined genetic engineering and molecular biology applications
Article Snippet: .. The previously designed 3 gRNA sequences were synthesized with the pU6 promoter by GenScript and cloned into the lentiviral pHIV-EGFP (Addgene, #21373) plasmid For lentivirus production, CRISPR-Prime Editing system encoding lentiviral pLenti-PE2-BSD plasmid DNAs (Addgene, # 161514) encoding CRISPR-PE containing the blasticidin resistance gene, control pHIV-EGFP non-coding pegRNA1/2/3, and coding GFP and pHIV EGFP coding pU6-pegRNA1/2/3 and GFP were transfected with pSPAX2 and pVSV-G envelope and packaging plasmid DNAs. ..
Transfection:Article Title: CRISPR.BOT an autonomous platform for streamlined genetic engineering and molecular biology applications.
Article Snippet: .. The previously designed 3 gRNA sequences were synthesized with the pU6 promoter by GenScript and cloned into the lentiviral pHIV-EGFP (Addgene, #21373) plasmid14 For lentivirus production, CRISPR-Prime Editing system encoding lentiviral pLenti-PE2-BSD plasmid DNAs (Addgene, # 161514) encoding CRISPRPE containing the blasticidin resistance gene, control pHIV-EGFP non-coding pegRNA1/2/3, and coding GFP and pHIV EGFP coding pU6-pegRNA1/2/3 and GFP were transfected with pSPAX2 and pVSV-G envelope and packaging plasmid DNAs. ..
Article Title: CRISPR.BOT an autonomous platform for streamlined genetic engineering and molecular biology applications
Article Snippet: .. The previously designed 3 gRNA sequences were synthesized with the pU6 promoter by GenScript and cloned into the lentiviral pHIV-EGFP (Addgene, #21373) plasmid For lentivirus production, CRISPR-Prime Editing system encoding lentiviral pLenti-PE2-BSD plasmid DNAs (Addgene, # 161514) encoding CRISPR-PE containing the blasticidin resistance gene, control pHIV-EGFP non-coding pegRNA1/2/3, and coding GFP and pHIV EGFP coding pU6-pegRNA1/2/3 and GFP were transfected with pSPAX2 and pVSV-G envelope and packaging plasmid DNAs. ..
RNA Expression:
Expressing:Article Title: Construction and Expression Analysis of the bin 3xOllas Tool Line
Article Snippet: Briefly, a bin.3×Ollas pBluescript II KS (-) (GenScript) donor was constructed containing 782 bp upstream and 776 bp downstream homology arms flanking a sequence encoding three tandem 14 amino acid Ollas tags (SGFANELGPRLMGK–SGFANELGPRLMGK–SGFANELGPRLMGK). .. The pU6-BbsI-chiRNA gRNA expression vector (Addgene) carrying two CRISPR target sites (5′-TAGGCCGGCTTGCGATCAATGGG-3′ and 5′-ATGCACGCCATCCCAAGTTGAGG-3′) was injected together with the bin.3xOllas donor into y 1 M{vas-Cas9}ZH-2A embryos (Bloomington 51323) by BestGene Inc.. .. The bin 3×Ollas allele was confirmed by Sanger sequencing (GATC services, Eurofins).
Article Title: An intron-based timer for circadian rhythms
Article Snippet: .. In brief, two gRNAs GTTCACTGGCGTCGAACTTG (gRNA-1) and GAACCTTGAGACCACTCCGC (gRNA-2) where cloned into the gRNA expression plasmid pU6-BbsI-chiRNA (Addgene #45946) using restriction enzyme (BbsI) cloning, which were confirmed by Sanger sequencing with T7 primer and prepared using Midi-prep (QIAGEN). .. Donor plasmid was cloned with the pBlueScriptII SK(-) backbone (GenScript, Inc.) which contains complete flanking exons of intron P with PAM sequences mutated to maintain the coding amino acid sequence (gRNA-1 PAM mutated to AGA and gRNA-2 PAM mutated to AGC). gRNA and donor plasmids were microinjected into germline Cas9 expression embryos (nos-Cas9 attp2, Rainbow Transgenic Flies, Inc.) and crossed individually with chr2 balancer line.
Injection:Article Title: Construction and Expression Analysis of the bin 3xOllas Tool Line
Article Snippet: Briefly, a bin.3×Ollas pBluescript II KS (-) (GenScript) donor was constructed containing 782 bp upstream and 776 bp downstream homology arms flanking a sequence encoding three tandem 14 amino acid Ollas tags (SGFANELGPRLMGK–SGFANELGPRLMGK–SGFANELGPRLMGK). .. The pU6-BbsI-chiRNA gRNA expression vector (Addgene) carrying two CRISPR target sites (5′-TAGGCCGGCTTGCGATCAATGGG-3′ and 5′-ATGCACGCCATCCCAAGTTGAGG-3′) was injected together with the bin.3xOllas donor into y 1 M{vas-Cas9}ZH-2A embryos (Bloomington 51323) by BestGene Inc.. .. The bin 3×Ollas allele was confirmed by Sanger sequencing (GATC services, Eurofins).
Cloning:Article Title: An intron-based timer for circadian rhythms
Article Snippet: .. In brief, two gRNAs GTTCACTGGCGTCGAACTTG (gRNA-1) and GAACCTTGAGACCACTCCGC (gRNA-2) where cloned into the gRNA expression plasmid pU6-BbsI-chiRNA (Addgene #45946) using restriction enzyme (BbsI) cloning, which were confirmed by Sanger sequencing with T7 primer and prepared using Midi-prep (QIAGEN). .. Donor plasmid was cloned with the pBlueScriptII SK(-) backbone (GenScript, Inc.) which contains complete flanking exons of intron P with PAM sequences mutated to maintain the coding amino acid sequence (gRNA-1 PAM mutated to AGA and gRNA-2 PAM mutated to AGC). gRNA and donor plasmids were microinjected into germline Cas9 expression embryos (nos-Cas9 attp2, Rainbow Transgenic Flies, Inc.) and crossed individually with chr2 balancer line.
Sequencing:Article Title: An intron-based timer for circadian rhythms
Article Snippet: .. In brief, two gRNAs GTTCACTGGCGTCGAACTTG (gRNA-1) and GAACCTTGAGACCACTCCGC (gRNA-2) where cloned into the gRNA expression plasmid pU6-BbsI-chiRNA (Addgene #45946) using restriction enzyme (BbsI) cloning, which were confirmed by Sanger sequencing with T7 primer and prepared using Midi-prep (QIAGEN). .. Donor plasmid was cloned with the pBlueScriptII SK(-) backbone (GenScript, Inc.) which contains complete flanking exons of intron P with PAM sequences mutated to maintain the coding amino acid sequence (gRNA-1 PAM mutated to AGA and gRNA-2 PAM mutated to AGC). gRNA and donor plasmids were microinjected into germline Cas9 expression embryos (nos-Cas9 attp2, Rainbow Transgenic Flies, Inc.) and crossed individually with chr2 balancer line.
|
